RegulonDB RegulonDB 10.9: Gene Sequence
yagJ gene sequence


Size: 732        A: 196  T: 178  G: 212  C: 146

Fasta

 

>yagJ E. coli K12. Version NC_000913.3 GI:556503834
atggaggctcgtgttaccgttgctggcatggggctggtgatggaggtgcaggattacttc
gatggcgaggccgatagactggcgaaggcgtggctggccgagtacacaccgcaaatcaag
tcgttgaaagatgagcgtaaagaggcctatcgtcaaatcgtcgaaatgagtaccgaaccg
caggatgtggatctggtcaggccggcgaacaagtttgaaatgaccagggtgcgtgaaggt
gaaaaggaagctgaccttccagtctggaaacaccatttgttgtgtgacgaaagcgggaac
tatccggctctgttgaaccattgggaaaccaaggtttttgagatcgaaaccaaacgtgaa
ggatttgctttctggtatcgtaatccacagtacacagggcagtcgtcactgggaatcgct
tatgttgaagctgaacagtacaagattgttcgtcccgatttcctgttctttgccgaacag
gatggcaaaatggttgtggacctggtagatccacatagcctacatctggctgatgctttg
cccaaactggaaggacttgcgctatatgccgaacatcattctgatgcttacaggcgaatc
gaatctgtcgccgaagtaaagggtaaattacgagtgttagatttgaaacggcaggatgtg
caggatgctgttgctaccgctgaaaatgcagaaacgttatttagtagcggacttgctgat
gactatcagtaa
              
                            

Download fasta file
RegulonDB