RegulonDB RegulonDB 10.9: Gene Sequence
yagK gene sequence


Size: 627        A: 183  T: 163  G: 143  C: 138

Fasta

 

>yagK E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacatatcaaggtactcatggagtacatatcctcgaatatcagagtaagattaat
aaattattatgttatttgactaaccggtatcctaggttaattgctgtacgtgtcgatctc
cactatcccaaaatagttgataacggtgacaatatctgttgcttccctaacctggaacct
ggggtgatatcccggatgcgtgaatccctcagagctaagctggaggctgaccgtacccgt
aaggtgcgtgaggataaacgcatttaccgttgccctttatttattatatgggcgaaagag
tattctgaatcaggtaaatgccactatcacatttgcctgttgttcaacaaagacgcttac
taccacctcggggattacgatcaggacgataaccttagagggatgatcacaggagcctgg
tacagcgccctgagactggagagagacgatcaccctggtctggtccattttcctgaaaac
tgtaagtatgtgctagacaccaatagtactgacttccagcagaactaccaggcgctgtta
acccgactggactacctgaccaaagttgaaagcaaagtgtttggtgaaggagaccgtaac
ttcggctgtagccaaatcgaactgtaa
              
                            

Download fasta file
RegulonDB