RegulonDB RegulonDB 10.9: Gene Sequence
yagL gene sequence


Size: 699        A: 232  T: 206  G: 139  C: 122

Fasta

 

>yagL E. coli K12. Version NC_000913.3 GI:556503834
atgagaggtaaaatactactttaccagttaaagtatcgctggcaatcactctctattttt
ggttgttttttatgcaaaatgacattattcaggtatcaaaaaataatttatgacaccgga
gtgcatcagatgcgttcatttttttacaccatatgcagtagcgaacagcaagaaagcatt
acagatcatcactcacttgctgagatatgccaaaaatttaatattctacctgaacatgtt
gtgatcgagcaggtagatattaaagaggttgtttcagagcaacgtttactcagacaattg
attcatcatgaaatgaaccggcaggacacgcttgtcattccagatctaagctgtcttggc
agaactgtggaggacttacagaatattttatttttttgccttcaaaaagaaatgtttatc
tacagctaccatccagcttcaaggatagagccttctgctgaaagttgcttgtcttttttg
attgctcgtcaggatacgattgacattcacaatctgaaatcaactaaaagccgatatcga
catgttaagaaaaaattaggacgaaaggagggaagcaaataccgacgtgatatcacaata
cttaagaaaggtggatttactcaggctgagattgcaaagaaattgagtatcagtttatcg
actgtgaagcggcactggaataacggaatcatcggttaa
              
                            

Download fasta file
RegulonDB