RegulonDB RegulonDB 10.9: Gene Sequence
yagM gene sequence


Size: 855        A: 307  T: 238  G: 157  C: 153

Fasta

 

>yagM E. coli K12. Version NC_000913.3 GI:556503834
atgtctaatagtgttactaattttgagatgagcagcgttctaccaggaaaaaaaccttgt
caaggcaaaaacaatgagtcacaggtagtacagactactcccataaaaaaacactcagtc
acgttcaaaaatcaatcttcattaggagtaattgatcattatgccagactaacaaataaa
tctcactcttccgtaatagcggaagttgtggatttggctatccctatattagaaaaatgc
aatcgtcataactggtcaataaatgaaataaaaaatgacctgttaaagttctctataaaa
gaaagcatcaatcgaagccgaggtaaaacagaagtaactctggaagagtactgttcgtta
atctggaaaacgaacatcatgagtccattaaaaatccccattgcagattactttcaactg
aacgctaatgatgaattcatggggaaagatgaaaaaacagttatacgtgaaaggctatcc
tcgctaagggaaaattacgatatggaaaaagccatttacatttacaatcaaagacatttt
gatgtaaagcatcaaagtgtctcaggatattcaaacattattcttattcatagaacaacc
tttgagggttattactttgatgccgggcaggctctactcttgtcaacatcccaattgatt
atattcgggataaatgaagttcttagaagaaaggggattgttatgccttatccggttgtt
tgttggattgatatttaccatgtcaatgaaatggtggttatgctgccagtgctccgcaaa
acagatgtttccaaccgtgttaatgtaccggatgacatcattataaacccatactcacaa
gagagcagaacctaa
              
                            

Download fasta file
RegulonDB