RegulonDB RegulonDB 10.9: Gene Sequence
yagN gene sequence


Size: 441        A: 134  T: 115  G: 78  C: 114

Fasta

 

>yagN E. coli K12. Version NC_000913.3 GI:556503834
atggcaaccccagcaactgtatccatagaacccactctggcagctatcagagctcgctgg
tgtattaattcaagtaaaacaactcaatcctttaacgatcctgcgtccatggaagaggtt
gtcgagtatctcaaaggaacatactcagctcttcgcaagtctgtcgcatgcgccaaactg
aaaattttacatcttaaacaaagaatgcaaaatgctactaactttctcgcgcgtctgatg
tcatgtaaaaatcaggcatccagatcgcatcacagtacggctaaatcagctaaaagtgcc
ttatcatcagattcaggtgatggtagtgaccccgaccccgagcccgaaacgtttccttct
gccttcattactacccctactaattcaataatgcttaaagctttctttgccaatatctca
atcactgaggtggcaaaatga
              
                            

Download fasta file
RegulonDB