RegulonDB RegulonDB 10.9: Gene Sequence
intF gene sequence


Size: 1401        A: 435  T: 345  G: 312  C: 309

Fasta

 

>intF E. coli K12. Version NC_000913.3 GI:556503834
atgtttattccctccatttacttacaccagcagttacattattgtaagacagcaattctc
aactggagccgaaaaatggcgctttcaagacaaaaatttaccttcgaaagacttcgcaga
ttcaccttaccggaagggaaaaaacaaacttttctttgggatgcagatgtaacaaccctg
gcatgccgagcaactagcggagcaaaagcctttgtattccaaagcgtatatgcggggaaa
acccttcgcatgactattggcaacattaacgactggaagattgatgatgcgagagccgag
gcaagacggttacaaacattgatcgatacagggatagatccacgaattgctaaggctgta
aaaatcgcagaagcagaatccctgcaggcagaatcacgtaaaacaaaagtgactttctcc
gtcgcctgggaagactatcttcaagaattgagaaccggtatcagtgcaaaaactaaacgc
ccatattctactcgatacattgccgatcacattaacttgtccagtcgtggaggcgaaagt
aaaaaaagaggccaaggcccgacttcggctggaccattggctagtttgctcaacctgccg
ttatcggagctaaccccagattacatagcagcgtggctgagtacagaaaggcaaaataga
cctaccgtcactgctcacgcttatcgcctactacgtgctttcatcaaatggagtaattat
cagaaaaaatatcaagggatcattcctggcgatctggcacaagattacaacgtaagaaaa
atggttcccgtgtcagcgagtaaagctgatgattgcctgcaaaaggaacaactaaaaagc
tggtttagtgccgtgcgtagcctcaataatcctattgcatcggcctatctccaagtactt
ttgctcactggtgctcggcgtgaagaaattgcgtcgcttcgctggtcagacgtagatttc
aaatggtcaagcatgcgaattaaagacaagatcgaaggtgaacgtatcatccctctcact
ccttatgtttctgaattgttaaatgtactagcgcaatccccaaattctgacgtaaataag
gagggttgggttttcagaagtaacagtaaaagtggcaaaattattgagccgcgttcagcg
cacaacagagcattagtgctggctgagttaccacatatcagccttcacggtttacgtcgt
agttttggtactttggccgagtgggttgaagttcccactggtattgttgctcaaattatg
ggacacaaacccagcgctcttgccgaaaaacactatcgccgtcgtccgttagatctgtta
cgaaaatggcacgagaaaattgagacatggatcttaaatgaagcaggtattaccataaaa
aacaacgttgatatgcgttga
              
                            

Download fasta file
RegulonDB