RegulonDB RegulonDB 10.9: Gene Sequence
yagP gene sequence


Size: 411        A: 89  T: 106  G: 107  C: 109

Fasta

 

>yagP E. coli K12. Version NC_000913.3 GI:556503834
atgcctgcccccgtcgtcctgatccttgcggccgggcgtggagagtgctttctcgcctcc
gggggaaatacccataagtgtatcggctggcgtcagtccccggaggttgcgccttatcgc
tggccatttgaagaaaacgggagaactttcgaccttgcgattgaaccgcagattacgact
aatgatctgcgtctgatgttgaggctggctcttgccggcggaggaataacaattgccact
caggaaactttcaggccatatattgaaagcggtaagcttgtatcgctgcttgatgacttt
cttccacaatttccgggcttctatctgtatttcccacagcgtcgcaatattgcaccaaag
ctccgcgccctgattgactacgtcaaagaatggcggcagcaattggcttaa
              
                            

Download fasta file
RegulonDB