RegulonDB RegulonDB 10.9: Gene Sequence
paoD gene sequence


Size: 957        A: 186  T: 197  G: 295  C: 279

Fasta

 

>paoD E. coli K12. Version NC_000913.3 GI:556503834
atgtcatacccgctttttgacaaagacgaacactggcataagccagagcaggcgtttctc
accgatgaccaccggaccattctgcgcttcgccgtagaggcgctaatgtccggtaaagga
gcggtgctggtgacgctggtggagatacgcggcggcgcggcgcgcccgctcggggcgcag
atggtggtgcgcgaagatggtcgttactgcggttttgtctctggcggctgcgtggaggcc
gctgccgcttttgaagcgctggagatgatgggctcaggccgcgatcgcgaaattcgctat
ggcgaaggttcgccgtggtttgacatcgttctgccctgcggcggtgggatcacgctgacg
ctccataaactacgctcggcacagcctctgctcgccgtgctgaaccgcctggaacagaga
aaaccggtggggctgcgctacgatccgcaagcacaatcgctggtgtgcctgcccacgcaa
acccggacgggctggaatctcaatggctttgaggtggggttcaggccatgcgtcaggctg
atgatttacggacgttctcttgaggcgcaggcaaccgcgagtcttgcagcagccacaggc
tatgacagccatatcttcgatctttttccggcctcagccagcgctcagatcgataccgat
acggcggtcattttgctgtgccatgatctcaaccgggagctgccagtgttgcaggccgcg
cgagaagcaaaacccttttatctcggcgcattgggcagctatcgaacccacacgttacgt
ctgcaaaagctccacgagctgggatggtccagggaggaaacaacgcaaatccgggcaccc
gtcgggatattccccaaagcccgggatgcgcatactctggcactctccgtgctggcagaa
gtcgcctctgtacgtctccatcaggaggaggattcatgcctgcccccgtcgtcctga
              
                            

Download fasta file
RegulonDB