RegulonDB RegulonDB 10.9: Gene Sequence
paoC gene sequence


Size: 2199        A: 482  T: 410  G: 661  C: 646

Fasta

 

>paoC E. coli K12. Version NC_000913.3 GI:556503834
atgaaatttgataaacccgcaggggaaaacccgatcgatcagctgaaggttgtcggtcgt
ccccatgaccgcatcgacggaccgctgaaaactaccggcacggcacgctacgcctacgaa
tggcatgaagaagcccccaacgccgcctatggctatatcgtcggttccgccattgccaaa
ggacgcctcaccgcccttgatacggacgccgcgcaaaaagcgccgggcgtactggctgtc
attaccgccagtaacgccggggcactcggcaaaggcgacaaaaacaccgccaggctgtta
ggcggccccactattgagcactatcatcaggccattgcgctggtagtggccgagaccttc
gaacaggcgcgagcggcggcctcgctggtgcaggcacactatcgccgtaataaaggagct
tactccctggcggacgaaaaacaggccgtcaatcagccgccggaagacacgcccgacaaa
aacgtcggtgactttgacggggctttcacctccgctgcggtgaagattgatgctacctac
acgaccccggaccagagccatatggcgatggagccgcatgcctcgatggccgtctgggat
ggaaataagcttaccctctggacctcaaatcagatgattgactggtgccgcaccgatctg
gcaaaaacgctgaaagttcccgtggagaatgtgcgtattatctccccgtatatcggcgga
gggtttggcggcaagctgttcctgagaagcgatgcgctgctggcggccctcgccgcccga
gcggtgaaacgtccggttaaagtgatgctcccccgcccctctattcccaataacaccacg
caccgccccgccacccttcagcacttgcgtatcggtgccgaccagagcgggaaaatcacc
gctatctcacatgaaagctggtctggaaacctgcccggcggcacgccggaaacggcggta
cagcaaagcgaattactctacgccggggcgaatcgtcataccggcctgcggctcgccacg
cttgatttgccggaagggaacgccatgcgtgcgcccggcgaagcccccggtctgatggcg
ctcgaaatcgcgatcgacgaactggcggaaaaagcgggcatcgatcccgtcgagtttcgc
atcctgaatgacactcaggttgaccccgccgacccgacgcgctgcttctctcgccgtcag
cttatcgagtgcttgcgcaccggagcggataaatttggctggaagcagcgcaacgccaca
cccggacaggtgcgcgacggggagtggctagtcggccacggtgttgcggcgggctttcgc
aataatctgctggaaaaatcgggtgctcgggttcacctcgaacaaaacggcaccgttacc
gtagaaacggacatgaccgacattggcaccggcagctacaccattctggcccagacggca
gcggaaatgcttggcgtaccgctggagcaggttgcggttcacctcggcgattccagtttc
ccggtttctgcgggttctggtggacaatggggcgcgaatacctccacctccggcgtttac
gccgcctgtatgaagcttcgcgaaatgattgcctcggcagtcgggtttgatcctgagcag
tcgcagtttgccgacggcaagattaccaacggtacccgaagcgccacgctacatgaagcc
accgcaggcggcagactgacagcggaagagagcattgaattcggaacactgagcaaagag
taccagcagtcgacctttgccgggcattttgtggaggtcggcgtgcatagcgcgacggga
gaagttcgggtccggcgtatgctcgctgtgtgtgctgcaggacgcatcctgaatccgaaa
actgcgcgcagccaggtcattggcgcaatgactatgggcatgggcgcggcactgatggag
gagctggcggtggatgaccgtttgggctacttcgttaatcacgatatggcggggtatgag
gtgccggttcatgcggatatcccaaaacaggaggtgattttcctggatgataccgacccc
atatcctccccgatgaaggccaaaggtgtcggtgagctgggcctgtgcggcgtgagcgcg
gctatcgccaacgcggtgtataacgccaccggtattcgggtacgggattatcccatcact
ctggataagctgctcgataagctgccggatgtggtttaa
              
                            

Download fasta file
RegulonDB