RegulonDB RegulonDB 10.8: Gene Sequence
paoA gene sequence


Size: 690        A: 169  T: 143  G: 191  C: 187

Fasta

 

>paoA E. coli K12. Version NC_000913.3 GI:556503834
atgagcaaccaaggcgaataccccgaagataatcgggttgggaagcacgagccgcacgat
ttaagtttgacccgtcgcgatctgattaaagtgagcgccgcaacagcggcgaccgccgtg
gtttatcctcattctacgctggcggcaagcgttccggcagctacacccgcgccagagata
atgcccctgacactgaaggtgaacggcaaaaccgagcagcttgaggtggatacccgaacc
acgctactggacactttgcgtgaaaatctgcatttgatcggtaccaagaaaggttgcgat
cacggacagtgcggagcctgtaccgtgctggtcaatggtcgcaggcttaatgcctgcctg
acgcttgcagtcatgcatcagggggccgagatcaccaccattgaaggcctgggttcgcca
gataatcttcaccccatgcaggcggcctttatcaagcatgatggcttccagtgcggctac
tgcacctccgggcaaatttgctcatcagtagcggtgctaaaagagattcaggacggcatt
cccagtcacgtcacggtcgatttggtttccgctccagaaacaactgccgatgagatccgt
gaacgtatgagcggcaacatctgtcgctgtggtgcatacgctaacatccttgccgccatt
gaagatgctgcgggggagataaaatcatga
              
                            

Download fasta file
RegulonDB