RegulonDB RegulonDB 10.9: Gene Sequence
yagU gene sequence


Size: 615        A: 135  T: 202  G: 147  C: 131

Fasta

 

>yagU E. coli K12. Version NC_000913.3 GI:556503834
atgaatatatttgaacaaactccaccgaaccgcagacgttatggtcttgctgcattcatt
gggctgattgctggcgttgtttccgcattcgtgaagtggggggctgaagttccattgccg
ccacgtagcccggtggatatgtttaatgcagcgtgtggcccggaatcattaatcagggct
gcaggccaaattgattgctcgcgtaattttctcaatccaccgtatatttttcttcgagac
tggttggggctgacagatcccaatgcggctgtttatacctttgccgggcatgtctttaac
tgggttggtgttacgcacattatcttttcgatagtgtttgctgtcggttattgtgtggtc
gctgaagtatttccaaaaattaaactctggcagggcttactggcaggtgctttagcccaa
ctttttgttcatatgatttcattccctctcatgggactgacgccacctctgtttgatctc
ccgtggtatgagaatgtttctgaaatttttggacatttagtctggttctggtctattgaa
attattcgcagagatttacgaaacagaattactcatgagccagaccctgagatcccttta
ggctcaaacagataa
              
                            

Download fasta file
RegulonDB