RegulonDB RegulonDB 10.9: Gene Sequence
ykgJ gene sequence


Size: 330        A: 85  T: 79  G: 80  C: 86

Fasta

 

>ykgJ E. coli K12. Version NC_000913.3 GI:556503834
atgagcaatctgaatccatgcatgacgtgtggtgcctgttgtgcatttttccgcgtctct
ttttactgggccgaagccgacgatgctggcggtactattcccgccaggctcactgaacaa
atatccccttttcaccgatgcatgagcggtaccaatcagaaaaacccccgatgtattgcc
cttgcaggaaccccgggcaaaaatgcctgctgcacgatatataaaaatcgatcgtccaca
tgcagagaattcgccatgtctggtgagaacggagtcgtcaatgaggcttgcaatcgtgca
agggctaaatacgggctgacaccgttataa
              
                            

Download fasta file
RegulonDB