RegulonDB RegulonDB 10.9: Gene Sequence
ecpE gene sequence


Size: 711        A: 170  T: 164  G: 197  C: 180

Fasta

 

>ecpE E. coli K12. Version NC_000913.3 GI:556503834
atgttcaggcgacgtggcgtaacattaactaaggccctgctgacagcggtctgtatgctg
gcggcacctttgacacaggcgatttcggtcggcaatctgacattttcgctgccgtccgag
actgactttgtcagcaaacgtgtagtgaataacaacaaaagcgcacggatataccgtatt
gccatcagtgctattgatagcccgggcagcagtgaattgcgcacccgaccggtggatggt
gaactgcttttcgccccccgccagctggcgttgcaggctggtgagagcgagtattttaaa
ttttactatcatggtccacgggataaccgcgagcgctactaccgggtctcatttcgcgag
gtccccactcgtaaccatacaagacgcagcccaaccggcggcgtggtcagcacggagccg
gtggtggtgatggataccattctggtagtacgaccacgtcaggttcagtttaaatggtcc
ttcgacaaggtgacaggaacggtaagtaacactggcaacacatggtttaagctactgatt
aagccaggatgtgattcgaccgaagaggaaggcgatgcctggtatctacgtccgggagac
gtggttcatcagcctgagttacgtcagccggggaatcactatctggtctataacgacaaa
ttcattaagattagcgattcctgtccggctaagcccccttcggcggactaa
              
                            

Download fasta file
RegulonDB