RegulonDB RegulonDB 10.9: Gene Sequence
ecpD gene sequence


Size: 1644        A: 423  T: 373  G: 416  C: 432

Fasta

 

>ecpD E. coli K12. Version NC_000913.3 GI:556503834
atgagagttaacctactaataacgatgataattttcgcgctaatctggccagtaactgcg
ctcagagcggcagtgagcaaaacaacctgggcggatgcaccggcacgcgagtttgtgttt
gtcgaaaacaactcagacgacaactttttcgtcactcctggcggggcgctggatccgcgc
ctgaccggtgccaaccgctggaccggtttaaaatacactggttcaggaaccatctatcag
caaagcctcggctacattgataacggttacaacaccggcctttataccaactggaagttt
gatatgtggctggaaaattcaccagtttcatctcctttaactggcttgcgctgcatcaac
tggtacgctgggtgtaatatgaccaccagtcttatcctgccgcaaaccaccgacgccagt
ggattttatggcgcgacggtgaccagcggcggcgcgaagtggatgcacggcatgttgtca
gacgcgttttaccagtatatgcaacaaatgcccgtcggcagcagctttacaatgaccatc
aatgcctgccagacctctgtgaactatgacgccagcagcggcgcacgctgtaaggatcag
gcctccggcaactggtatgttcgcaacgtcacccatacgaaagcagcaaatctacggttg
ataaatacccactcgctggcggaagtatttatcaacagcgacggagtaccgactctgggc
gaagggaacgccgactgccggacgcaaaccatcggcagccgttcaggattaagttgtaag
atggttaactataccctgcaaacaaacggactcagcaacacctcaatccatatattcccg
gcgatcgccaactcgtcgttagcctcggccgtcggggcgtacgatatgcagttcagtctg
aatggcagttcatggaaaccggtgagcaataccgcctattactacaccttcaacgagatg
aagagcgcagactcgatctatgttttcttctcgagcaacttctttaagcagatggtgaac
ctcgggatcagcgatatcaacaccaaagatctattcaactttcgctttcagaacaccaca
tcaccggagtctggctggtatgaattttctacctccaacacgctgattatcaaaccccgt
gatttcagcatcagtattatctccgatgaatatactcagacaccgtcgcgggagggatat
gttggcagcggcgagtcggcactcgatttcggctatatcgtaaccaccagcggtaaaaca
gctgccgacgaagtgctgatcaaggtgaccggacccgcgcaggtgattggcgggcgctcc
tattgtgtcttcagctccgatgacggtaaggcgaaagtaccgttcccggcgacactttcc
tttattacccgcaacggagctacaaaaacctacgatgccgggtgcgatgatagctggcgg
gatatgaccgatgcgctgtggttgaccacaccgtggactgatatctctggcgaagtgggg
cagatggataagaccacagtcaaattttcgattccaatggataacgccatttcgctgcgt
acggtagatgataacggctggtttggcgaagtcagcgcttcaggagagattcatgttcag
gcgacgtggcgtaacattaactaa
              
                            

Download fasta file
RegulonDB