RegulonDB RegulonDB 10.9: Gene Sequence
ecpC gene sequence


Size: 2526        A: 616  T: 514  G: 718  C: 678

Fasta

 

>ecpC E. coli K12. Version NC_000913.3 GI:556503834
atgcctttacgacggttctccccaggactgaaagcccagtttgccttcggcatggtcttt
ttgttcgttcagcccgatgccagcgctgctgacataagtgcgcagcaaataggtggggtg
attattccgcaggccttcagtcaggcgcttcaggacggcatgagcgtcccgctctatatt
catctcgccggtagccagggtcgccaggacgatcagcgaatcggcagcgcttttatctgg
ctggacgatggacagctacgcatccggaaaatacagctggaagagagtgaagataacgcc
agtgtcagcgaacaaactcgacagcagctgatggctctggccaacgccccgttcaatgag
gcccttaccatccccctgactgacaacgcgcagctggatctcagcttgcgccaactgctg
ctgcagctagtggtcaagcgcgaagcgctgggcaccgtactacgctcacgtagcgaagac
atcgggcagtccagtgttaacaccctcagcagtaatctgagctataacttgggcgtctat
aacaaccagttgcgtaacggcgggagcaacacatccagctatctgtcgctgaataacgtt
actgcactgcgcgaacatcatgtggtgctcgacggctcgctgtacgggatcggtagcggt
caacaggacagtgaattatataaagcgatgtatgaacgcgattttgccggtcaccgattt
gccggtggaatgctcgacacctggaacttgcagtccttagggccgatgaccgccatttca
gcagggaagatttacggcctttcctggggaaaccaggccagctccaccatcttcgacagc
agccagtcagccacgccagtgatcgcctttttaccggcggcgggcgaagtacatctcacc
cgtgatgggcggctactaagcgttcagaacttcactatgggcaatcatgaagtggatacc
cggggtctaccgtacgggatttacgatgtggaagttgaggtgatcgttaacggtcgcgtg
atcagcaaacgcacccagcgggtcaataagctgtttagccgggggcgcggcgtcggtgca
ccactggcgtggcaggtatggggcggtagctttcatatggatcgctggtcggaaaacggg
aaaaagacgcgaccagctaaagagagttggctagcaggtgcctcgacctccggctcattg
agtacgcttagctgggcggcaacgggatatggatacgataatcaggcggtgggtgaaacc
cgtctgacgctgccgcttgggggggcgatcaacgttaacctgcaaaatatgctggccagt
gacagctcatggagcagcatcggcagcatcagcgccactctaccgggaggctttagttcg
ctgtgggttaatcaggaaaaaacccgcattggcaatcaattgcgacgtagcgatgccgac
aaccgtgcaatcggcggcacactcaacctgaactcactgtggtcgaagctgggcacattc
agcatcagctacaatgatgaccgccgttacaacagccattattacacggcagattactat
caaaatgtctacagcggtacctttggttcgcttggcctgcgggccggtattcagcgctat
aacaacggcgacagcaacgccaatacaggaaaatatatcgctctcgatctctcgctacca
ctgggcaactggtttagcgcagggatgactcatcaaaacggctacaccatggcaaacctg
tcagcacgcaaacagtttgatgaaggaaccattcgcactgttggtgccaatctgtcacgt
gccatctccggcgataccggtgatgacaaaaccctcagcggcggggcgtatgcacaattc
gacgctcgttacgccagcggaacgctgaacgtcaatagcgcggcggacggctacgtcaat
accaacttgaccgccaatggcagcgtcggctggcagggtaaaaacattgctgccagcggg
cggactgatggcaacgctggggtgatattcaacaccgggctggaggacgacggtcagatc
agcgccaaaatcaacgggcggattttcccgcttaacggcaagcgtaactatctcccgctc
tctccctatggaagatatgaggtggagttacagaacagcaaaaactcactcgacagttac
gatatcgtcagcggccgcaaaagtcgtctgactctctatccaggcaatgtcgctgtcatt
gagccagaggtgaagcagatggttaccgtctccggtcgtatccgtgcggaagacggcaca
ctgctggctaacgcacggattaacaaccatatcggccgaacccgaaccgatgaaaacggc
gagtttgtcatggacgtggataagaaataccccactatcgattttcgctacagtggcaat
aaaacctgcgaagtggctctggaactcaaccaggcgcgcggtgccgtctgggtcggtgat
gtggtctgcagcggcctctcatcgtgggcggcggtgacgcagacaggagaagagaatgag
agttaa
              
                            

Download fasta file
RegulonDB