RegulonDB RegulonDB 10.8: Gene Sequence
ecpR gene sequence


Size: 591        A: 199  T: 161  G: 139  C: 92

Fasta

 

>ecpR E. coli K12. Version NC_000913.3 GI:556503834
gtgacatggcaaagtgattacagtagggactatgaggttaaaaaccatatggaatgtcaa
aaccgttctgataaatacatctggtctccccatgacgcctacttctataaaggactatct
gaactgattgtggatatcgacagattaatttatctatcgttggagaaaattagaaaagat
ttcgtgtttatcaatctcagtacggattctttatctgaatttataaaccgtgataatgaa
tggttatccgcggtaaaggggaaacaggtcgtattgattgcggccagaaagtcagaggcc
ttagcaaattattggtattacaatagcaatattaggggcgtggtatacgctggactgagt
cgtgatattagaaaagaactggtctatgtgattaatggcaggttcctgagaaaagatatt
aagaaagataaaatcacggaccgggaaatggaaattatccgcatgacggcccagggaatg
caacctaaatcgattgccagaattgaaaattgtagtgtgaagacagtgtatacccatcgg
cgtaatgctgaggccaagctgtactcaaaaatatataagttggttcagtaa
              
                            

Download fasta file
RegulonDB