RegulonDB RegulonDB 10.9: Gene Sequence
ykgM gene sequence


Size: 264        A: 75  T: 68  G: 65  C: 56

Fasta

 

>ykgM E. coli K12. Version NC_000913.3 GI:556503834
atgaagcccaatatccatcctgagtatcgtactgtggtgttccacgacaccagtgttgat
gagtactttaaaatcggctcgactatcaaaacagaccgtgagattgagctggatggcgta
acgtatccatacgtgacaattgatgtctcttctaaatcgcacccgttctatacagggaag
ctgagaacagtggcatcagaaggaaatgttgcacgattcacccaacgttttggtcgtttt
gttagcacgaaaaagggggcgtga
              
                            

Download fasta file
RegulonDB