RegulonDB RegulonDB 11.0: Gene Sequence
ykgA gene sequence


Size: 687        A: 196  T: 195  G: 139  C: 157

Fasta

 

>ykgA E. coli K12. Version NC_000913.3 GI:556503834
atgatcaggcagaagattctacagcagctcctggagtggattgagtgcaatcttgagcac
cctatttcaatcgaagatatcgcacagaaatctggctacagcagacgcaacatccagctt
ctgttccgaaatttcatgcatgtgcctttgggagaatacattcgcaaacgaaggctttgt
cgtgccgccattcttgtccggctcaccgcgaaatctatgcttgatattgcactctctttg
cattttgattcacagcagtcattcagccgcgaatttaaaaagttattcggctgctctccc
cgtgaataccgccaccgtgattattgggatctcgcaaatatcttcccttcttttttaata
cgtcaacagcaaaagacggagtgtagattaatcaactttcctgagacacctatttttggc
aactcatttaaatatgacattgaagtgtcgaataaatcaccggatgaagaagtcaaacta
cgacgtcatcatttagccagatgtatgaagaattttaagacggatatctatttcgtttcc
acgtttgaaccgtcaacaaaatcggtcgatttgctcacggttgaaacttttgctggtacg
gtatgtgaatatgctgacatgccaaaagagtggacaacgacccgaggactttatgatcct
acccacgtaatatggacacaggcctaa
              
                            

Download fasta file
RegulonDB