RegulonDB RegulonDB 10.9: Gene Sequence
ykgE gene sequence


Size: 720        A: 183  T: 173  G: 208  C: 156

Fasta

 

>ykgE E. coli K12. Version NC_000913.3 GI:556503834
gtgaatgtcaatttctttgtcacctgtattggtgacgccctgaaatcaagaatggcacga
gactccgtgctgctactggaaaaactcggctgtcgcgtaaatttcccggagaaacaggga
tgctgcggtcagcctgcgatcaatagcggttatatcaaagaagcgattccagggatgaaa
aatctgatcgccgcactggaggataacgacgatcccattatttcaccggctggctcttgc
acctatgccgtaaaaagttacccgacgtatctggcggatgaacctgaatgggcatcacgt
gccgcaaaggttgccgcgcgtatgcaggatctcacctcttttattgttaataaattaggg
gtagtcgatgtaggtgccagtttgcaagggagagcggtgtatcacccatcttgtagcctg
gcccgtaagctgggagtgaaggacgagccacttacgctgctgaaaaatgtgcgtggactg
gagctgttgacctttgctgaacaggatacctgctgcggatttggcggcacgttctcggtc
aaaatggccgaaatatccggcgagatggtgaaagaaaaggttgcgcacctgatggaagtc
cgccctgagtatttaattggtgctgacgtgagttgcctgctaaacatcagtgggcgatta
caacgggaagggcagaaagtcaaagtgatgcatattgctgaagtgttgatgagccgctga
              
                            

Download fasta file
RegulonDB