RegulonDB RegulonDB 10.9: Gene Sequence
ykgF gene sequence


Size: 1428        A: 367  T: 344  G: 403  C: 314

Fasta

 

>ykgF E. coli K12. Version NC_000913.3 GI:556503834
atgtcgatcaaaaccagtaatacagattttaagacacgcatccgtcagcaaattgaagat
ccgatcatgcgcaaagcggtggcaaacgcgcagcagcgtattggggcaaatcggcaaaaa
atggtcgatgaattggggcactgggaggagtggcgcgatcgggccgcccagatacgtgat
catgttctgagtaatctcgacgcttatctgtaccagctctcagaaaaagtgacgcaaaac
ggcggtcacgtctattttgcaagaaccaaagaagacgctacccgctacattttacaggtt
gcccaacgcaaaaatgcccggaaggtggtgaaatctaaatcgatggtgaccgaagagatt
ggtgtcaatcatgtgttgcaggatgctggcattcaggtgattgaaaccgatctgggtgaa
tatattctccagctggatcaagatccgccatctcatgttgtggtcccggcaattcataaa
gatcgccatcagatccgtcgagtgctacacgaacgtctgggctatgaggggccggaaacg
cctgaagcgatgaccttattcatccggcaaaaaatccgcgaagatttcctcagtgctgaa
ataggtattaccggctgtaatttcgcggtggcagagaccggttcggtatgcctggtgacc
aatgaaggtaatgcgcgaatgtgtaccacgctgcctaaaacgcatattgcagtgatggga
atggagcgtattgcccccacgtttgccgaggtagatgtattgatcaccatgctggcgcgc
agtgccgttggtgcacgtttgacgggatacaacacctggctgacaggaccgcgcgaagct
gggcacgttgatggtcctgaagagtttcatctggttattgtcgataacgggcgttctgag
gtgctggcctctgaatttcgggatgtgctgcgctgtattcgctgcggggcttgtatgaat
acttgtccggcatatcgccatattggcggtcatggatatggctctatttatccagggcca
attggtgcggtgatttctccgctacttggcggctataaagattttaaagatttaccctac
gcctgctctttatgcacagcttgtgacaacgtgtgtccggtgcgtattccgctgtcaaaa
ctgattttgcgtcatcgtcgggtgatggctgaaaaagggatcaccgcaaaagcagagcaa
cgggcgataaaaatgttcgcttatgccaatagtcatccaggattgtggaaagtcgggatg
atggccggtgctcatgcggcaagctggtttatcaatggcggcaaaacaccactcaaattt
ggcgcgattagcgactggatggaagcacgcgatcttcctgaagctgacggagagagtttc
cgtagttggtttaagaaacatcaggcgcaggagaaaaagaatggataa
              
                            

Download fasta file
RegulonDB