RegulonDB RegulonDB 10.9: Gene Sequence
ykgG gene sequence


Size: 696        A: 166  T: 167  G: 208  C: 155

Fasta

 

>ykgG E. coli K12. Version NC_000913.3 GI:556503834
atggataatcgaggcgaatttttgaataacgttgctcaggcactgggtcgcccgctgcga
cttgaaccgcaagcagaagatgcgccgcttaacaactatgctaacgagcggcttacccaa
cttaaccaacagcagcgctgtgacgcgtttattcagtttgccagcgatgttatgttgacg
cgctgtgagctgaccagcgaggcgaaggcggcagaagctgcaatacgtctgtgtaaagag
ctgggagatcagtcggtcgtgattagcggtgacacgaggctggaggaattggggattagc
gaacgtttgcagcaggaatgcaatgccgttgtttgggatccggcgaaaggtgccgagaat
atctcgcaggcagagcaggctaaagtgggtgttgtgtatgctgaatatggtttaaccgaa
tcgggaggcgtggttcttttttccgccgccgagcgcgggcgttcattgagcctgctcccg
gaatattctctttttatcctgcgtaaaagcactatcctgccgcgtgtagcgcaactcgca
gaaaaattgcatcagaaagcgcaggccggtgaacgaatgccttcctgcattaacatcatt
agcggccccagttcaacggcggatattgagcttatcaaagtcgtcggagttcatggcccg
gtgaaagcggtgtatctgattattgaggattgttga
              
                            

Download fasta file
RegulonDB