RegulonDB RegulonDB 10.9: Gene Sequence
b0309 gene sequence


Size: 213        A: 58  T: 64  G: 39  C: 52

Fasta

 

>b0309 E. coli K12. Version NC_000913.3 GI:556503834
atggatgcctgtctttttcactgtaaatatcctggcattggtaataccaggatatttaca
gaagagcagcataaccatgacggaacggggttaagtcaggttgtcctaaacgctattttc
aacctcgtatgccttcttcaggtttatgtccagacttcatatctctctcaacaatcctca
ataatcagatacaccgctttcaccgggccatga
              
                            

Download fasta file
RegulonDB