RegulonDB RegulonDB 10.10: Gene Sequence
yahC gene sequence


Size: 498        A: 89  T: 146  G: 159  C: 104

Fasta

 

>yahC E. coli K12. Version NC_000913.3 GI:556503834
atgaacggactcacggcaacgggtgtcaccgtcggtatttgtgcagggctttggcagtta
gtgtcttcacatgtcgggctctctcaaggatgggaattattaggaaccattggcttcgtc
gccttttgcagtttttatgccgcaggcggcggtaaatcggggtttatcagaagtctggcg
gttaattattccgggatggtgtgggcgtttttcgccgcgctgactgctggttggctggcc
tctgtaagtggactgtccgcgttctgggcgagcgtaattactaccgtacccttctcggcg
gtagtggtctggcaagggcgtttctggttactgtcctttattcccggtggctttctcggc
atgacgctgttttttgccagcgggatgaactggacggtgacgttactgggttttctggcg
ggtaactgcgtgggggtaatttcagaatatggtggacaaaaattaagcgaagcgacgact
aaacgcgacgggtattaa
              
                            

Download fasta file
RegulonDB