RegulonDB RegulonDB 10.8: Gene Sequence
yahD gene sequence


Size: 606        A: 170  T: 161  G: 151  C: 124

Fasta

 

>yahD E. coli K12. Version NC_000913.3 GI:556503834
atgagtataaaaaatctacctgccgactatttattggctgcacaacagggtgatatcgat
aaagtaaaaacctgccttgcgctgggtgtcgatattaatacctgcgatcgtcaggggaaa
acggcaattacgctggcaagtttatatcagcaatatgcttgcgttcaggcattaattgat
gccggagcggatattaataagcaagatcatacctgtttaaatccttttttaattagctgt
ctgaacgatgatttaacgctactacgaattattttaccggctaaacccgatcttaattgc
gtaacccgttttggcggtgtcggcctgacgcctgcctgtgaaaaaggccatttaagtatt
gtaaaagagcttttggcgcatacggagattaacgttaaccagaccaaccatgtaggctgg
acgccgctactggaagcgattgtgcttaatgatggtggtattaaacagcaggcgattgtg
cagttattgctggaacacggtgccagcccgcatctgaccgataaatatggcaaaacgcca
ctggaactggcgcgggaacggggctttgaagagattgcgcagttactgattgccgcaggt
gcataa
              
                            

Download fasta file
RegulonDB