RegulonDB RegulonDB 10.9: Gene Sequence
yahG gene sequence


Size: 1419        A: 304  T: 287  G: 447  C: 381

Fasta

 

>yahG E. coli K12. Version NC_000913.3 GI:556503834
atgagccagtcactgtttagccaaccattgaacgttattaacgtcggcatcgccatgttt
agcgatgacctgaaaaagcagcatgtagaagtgactcaactcgactggacgccgccgggg
cagggcaatatgcaggtggtgcaggcgctggataacattgccgattcgccgctggcggac
aaaatcgccgccgctaaccagcaggcgctggagcgtattatccagtcgcatccggtgctg
attggttttgatcaggcgattaacgtggtgccgggcatgacggcgaaaaccattcttcac
gccgggccgccgatcacctgggaaaaaatgtgcggcgcgatgaaaggcgcggtcaccgga
gcgctggtgttcgaaggactggcgaaagatctcgacgaggcggctgaactggcggcttcc
ggggagatcaccttctcgccgtgtcacgagcacgactgcgtgggatcgatggcgggtgtt
acctcggcctcgatgtttatgcacatcgtaaaaaacaaaacctacggcaacatcgcttat
accaacatgagcgagcagatggcgaagattttgcgtatgggcgctaacgaccagagcgtg
attgaccgcctgaactggatgcgtgatgtgcagggaccaatactgcgcgacgcgatgaaa
attatcggcgaaatcgatctgcgcttaatgctggcgcaggcgctgcatatgggcgatgag
tgccataaccgcaataacgccgggacgacactgctgattcaggcgctgacgccggggatt
attcaggcgggttattccgtcgagcaacagcgcgaagtgtttgagtttgtcgccagcagc
gactacttctccggcccgacgtggatggcgatgtgtaaagcggcgatggatgcggcgcat
ggcatcgaatacagcaccgtggtcaccaccatggcgcgtaacggcgtcgagttcggcctg
cgggtcagcggcctgccggggcaatggtttaccggcccggcgcagcaggtgatcggcccg
atgtttgccggttataagccggaagattcggggctggatatcggcgacagcgccatcacc
gaaacctacggtattggcggatttgctatggcgaccgcgcccgctatcgtcgcgctggtg
ggcggcacggtggaagaagctattgatttctcccgtcagatgcgcgaaatcaccctcggt
gaaaaccccaacgtcaccattccgctgctcggttttatgggcgtgccgtcggcaatcgac
atcacccgcgtgggtagcagcggcattctgccggtgatcaacaccgccatcgcccataaa
gatgcgggcgtcggcatgattggcgcgggcattgtgcatccaccttttgcctgcttcgag
aaagccattcttggctggtgcgaacgttacggcgtctga
              
                            

Download fasta file
RegulonDB