RegulonDB RegulonDB 10.10: Gene Sequence
yahJ gene sequence


Size: 1383        A: 337  T: 268  G: 392  C: 386

Fasta

 

>yahJ E. coli K12. Version NC_000913.3 GI:556503834
atgaaagaaagcaatagccgccgtgaatttctgagccagagcggtaagatggtcaccgcc
gccgcgctgtttggtacctctgtgccgctcgcccatgcggcggtagctggcaccctaaac
tgcgaagcgaacaacaccatgaaaatcactgacccgcattactatctcgataacgtgctg
ctggaaaccggttttgactacgaaaatggcgtggcggtgcagacccgcacggcgcgccag
accgtggagattcaggacggcaaaattgtcgccctgcgcgagaacaagctgcatccggac
gccacgctgccgcactatgacgctggcggtaagctgatgctgcccaccacccgcgacatg
catattcatctcgacaaaaccttttacggcgggccgtggcgctcgctcaatcgtccggca
ggcaccaccatccaggacatgatcaaactcgagcagaaaatgctgccggaactgcaaccg
tacactcaggagcgggcagaaaaactgattgatttattgcagtcgaaaggcaccaccatt
gcccgcagccactgcaatatcgaaccggtttccggcctgaaaaatctgcaaaatttgcag
gcggtgctggcgcgacgtcaggcgggctttgagtgtgaaatcgtcgccttcccgcagcac
ggtttgctgctgtcgaaatctgaacctttaatgcgtgaagcgatgcaggcgggggcgcat
tacgtcggcggcctggacccgaccagtgttgatggcgcgatggaaaaatccctcgacacc
atgttccagattgcgctggactacgacaaaggcgtcgatattcacctgcacgaaaccact
ccggcaggcgtggcagccatcaattatatggttgaaacggtagagaaaacgccacagctg
aagggcaagctgaccatcagtcacgcctttgcgctggcaacgctcaacgagcaacaggta
gatgaactggcgaaccggatggtggtgcaacaaatttctatcgcctcgacggtgccgatt
ggcacgctgcatatgccgctcaaacagttgcacgacaaaggcgtaaaagtgatgactggc
actgacagcgttatcgaccactggtcgccttatggtctgggcgacatgctggaaaaagcc
aatctgtacgcgcagctctatattcgtcctaacgaacagaacctctcccgctcgctgttt
ttagccactggcgatgtattgccgctgaatgaaaaaggcgagcgtgtatggccaaaagcg
caggatgacgccagctttgtgctggtggacgcctcctgttccgccgaggcggtggcgcgt
atctcgccgagaaccgcaacgttccataaagggcaactggtgtgggggagtgtggcaggt
tga
              
                            

Download fasta file
RegulonDB