RegulonDB RegulonDB 10.9: Gene Sequence
yahL gene sequence


Size: 816        A: 250  T: 249  G: 168  C: 149

Fasta

 

>yahL E. coli K12. Version NC_000913.3 GI:556503834
atgatatcattaaaagctccgcacaataatttgatgccatatacgcaacaaagcatactt
aatacggttaaaaacaatcagttaccagaggatatcaaaagctccctggtttcctgtgtc
gatatattcaaggttttgattaaacaatattatgattatccttatgattgtcgtgatgat
ttagtcgatgacgacaaactcattcatctcatggctgccgtacgagactgtgagtggtca
gacgataacgcactcaccataaatgtgcagtttaatgatttccctggattttatgactgg
atggattaccctgatcacccggttaagtttgtttttcacatacttgaaaatcaaaaaggg
acagtttgggtatatgaccaggatgatgcgtttcttgatattaaagcaaacgtgcaggct
ggacgctttaccgggcttaagaaattagtgcagtttatcgattcagtgcgaacagattgc
aaatgtattcttcttgaataccatatgcctttgctgagaattttccctaaagggaaagag
tgtatgcatgtggaaaaatggcttcgcgaaatgtcgtctattccggagacagacgcgccc
attaagcaggcgcttgcgcatggattattattacacttaaaaaatatctaccctgttttt
cctgaatcactggtgatgttattgctctctgttctggacgtaaaaacatacagagatgat
gcgcgattaaatgaatggatatctaatagagtgcaggaattaggtgacagatattatcct
gtaaataagcacgttaaaatccgctacactctttag
              
                            

Download fasta file
RegulonDB