RegulonDB RegulonDB 10.9: Gene Sequence
yahM gene sequence


Size: 246        A: 74  T: 57  G: 62  C: 53

Fasta

 

>yahM E. coli K12. Version NC_000913.3 GI:556503834
atggcggtccaacttttcaaaactcttctgaatcagatccccttattatcatccctgcaa
agtggaacattgccattgtttggctattcaggatggggcagaccaatgaaaaaagcccac
acaggggagagtgggctgaaatgggaagctaaagactcaagtaaacttatcggaaataag
gaccacgcattacgggggctatcatcgccgatggccgtgattcggcaaatcaggttgatt
acgtag
              
                            

Download fasta file
RegulonDB