RegulonDB RegulonDB 10.9: Gene Sequence
yahN gene sequence


Size: 672        A: 130  T: 210  G: 178  C: 154

Fasta

 

>yahN E. coli K12. Version NC_000913.3 GI:556503834
atgatgcagttagttcacttatttatggatgaaatcactatggatcctttgcatgccgtt
tacctgaccgtaggactgttcgtgattactttttttaatccgggagccaatctctttgtg
gtagtacaaaccagcctggcttccggtcgacgcgcaggggtgctgaccgggctgggcgtg
gcgctgggcgatgcattttattccgggttgggtttgtttggtcttgcaacgctaattacg
cagtgtgaggagattttttcgcttatcagaatcgtcggcggcgcttatctcttatggttt
gcgtggtgcagcatgcgccgccagtcaacaccgcaaatgagcacactacaacaaccgatt
agcgccccctggtatgtcttttttcgccgcggattaattaccgatctctctaacccgcaa
accgttttattttttatcagtattttctcagtaacattaaatgccgaaacaccaacatgg
gcacgtttaatggcctgggcggggattgtgctcgcatcaattatctggcgagtttttctt
agtcaggcgttttctttgcccgctgtgcgtcgtgcttatgggcgtatgcaacgcgttgcc
agtcgggttattggtgcaattattggtgtattcgcgctacgcctgatttacgaaggggtg
acgcagcggtga
              
                            

Download fasta file
RegulonDB