RegulonDB RegulonDB 10.9: Gene Sequence
yahO gene sequence


Size: 276        A: 103  T: 66  G: 64  C: 43

Fasta

 

>yahO E. coli K12. Version NC_000913.3 GI:556503834
atgaaaataatctctaaaatgttagtcggtgcgttagcgttagccgttaccaatgtctat
gccgctgaattgatgaccaaagcggaatttgaaaaagttgaatcgcagtatgaaaaaata
ggtgatatttcaaccagcaatgaaatgtcgactgcagatgcaaaagaagatttgatcaaa
aaagcggatgaaaaaggggctgatgtgttggtactgacctccggtcaaactgacaataag
atccacggcacggcaaatatttataagaagaagtaa
              
                            

Download fasta file
RegulonDB