RegulonDB RegulonDB 10.9: Gene Sequence
prpR gene sequence


Size: 1587        A: 364  T: 347  G: 455  C: 421

Fasta

 

>prpR E. coli K12. Version NC_000913.3 GI:556503834
atggcacatccaccacggcttaatgacgacaaaccggttatctggacggtatctgtaacg
cgcctgttcgagctgtttcgcgatatcagcctcgagtttgatcacctggcgaacattacc
cctattcagcttggctttgaaaaagcagtgacctacatccgcaagaaactggcaaacgaa
cgctgtgacgccatcatcgcggctggctctaacggcgcgtacctgaaaagccgcctgtca
gtgccagttattttgattaaaccgagcggctacgatgtgttacaggcactggcaaaagcc
ggaaaactcacctcttctatcggcgttgtcacctatcaggaaaccattccagcgctggtg
gcgtttcaaaaaacctttaatttgcgcctcgaccaacgtagctacattaccgaggaagac
gcacgcgggcagattaacgagctaaaagctaacggcaccgaagcggtggtcggcgcaggg
ctgattaccgatttggcagaagaagccggaatgaccggaatttttatctattccgccgcc
accgtgcgccaggcgttcagcgatgcgctggatatgacgcgcatgtcgttacgccataac
actcacgatgccacccgcaacgccctgcgtactcgttacgtgctgggcgatatgctcggt
caatcaccacagatggaacaagtacggcagactattttgctgtatgcccgctccagtgcg
gcggtgttgattgagggggaaacggggacgggcaaagagctggcggcccaggcgattcat
cgggaatattttgcccgccacgatgcgcgacagggcaaaaagtcgcatccgtttgttgcc
gtcaactgcggggcgattgccgaatcgctgctggaagcagaactgtttggctatgaggaa
ggggcgtttaccggctcgcgacgcggaggtcgcgccgggctgttcgaaattgcccacggc
ggtacgctgtttctggatgagattggcgaaatgccgctacctttgcagacccggctgctg
cgggtgctggaagaaaaagaggtcacccgcgtcggcgggcatcagcctgttccggtagat
gtacgggtcattagcgccactcactgcaatctggaagaagatatgcagcaaggacgtttt
cgccgtgatctgttttatcggctgagtattttgcgtctgcaattgccaccactgcgcgag
cgggtggcggatattcttccgctggcggaaagctttttgaaagtgtctctggcggcgctc
tccgccccattttctgctgcattacgccaggggttacaggcaagtgaaactgtgctgctg
cactacgactggccaggcaatattcgtgaactgcgcaatatgatggaacgactggcgctg
tttttaagtgtggaaccgacgccggatttaacgccgcagtttatgcaactgctactgccg
gaactggcgcgcgagtcggcgaaaactcccgctccacgcttactgacaccacaacaggca
ctggagaaatttaatggcgataaaacagcagcggcgaattatttaggcatcagccggacg
acgttctggcggcggctgaaaagctga
              
                            

Download fasta file
RegulonDB