RegulonDB RegulonDB 10.10: Gene Sequence
prpB gene sequence


Size: 891        A: 192  T: 199  G: 259  C: 241

Fasta

 

>prpB E. coli K12. Version NC_000913.3 GI:556503834
atgtctctacactctccaggtaaagcgtttcgcgctgcactgactaaagaaaatccattg
cagattgttggcaccatcaacgctaatcatgcgctgttggcgcagcgtgccggatatcag
gcaatttatctttctggcggtggcgtggcggcaggttcgctggggctgcccgatctcggt
atttctacccttgatgatgtgctgaccgacattcgccgtatcaccgacgtttgttcgctg
ccgctgctggtggatgcggatatcggttttggttcttcggcctttaacgtggcgcgcacc
gtgaaatcgatgattaaagccggtgcggcaggattgcatattgaagatcaggttggtgcg
aaacgctgcggtcatcgtccgaataaagcgatcgtctcgaaagaagagatggtggatcgg
atccgcgcggcggtggatgcgaaaaccgatcctgattttgtgatcatggcgcgcaccgat
gctctggcggtagaggggctggatgcggcgatcgagcgtgcgcaggcctatgttgaagcg
ggtgccgagatgttgttcccggaggcgattaccgaactcgccatgtaccgccagtttgcc
gatgcggtgcaggtgccgatcctcgccaacatcaccgaatttggtgccacgccgctgttt
accaccgacgaattacgcagcgcccatgtcgcaatggcgctgtacccactttcagcgttc
cgcgccatgaaccgcgccgctgaacatgtctacaacgtcctgcgccaggaaggcacgcag
aaaagcgtcatcgacaccatgcagacccgcaacgagctgtacgaaagcatcaactactac
cagtacgaagagaagctcgacaacctgtttgcccgtagccaggtgaaataa
              
                            

Download fasta file
RegulonDB