RegulonDB RegulonDB 10.8: Gene Sequence
prpE gene sequence


Size: 1887        A: 374  T: 411  G: 614  C: 488

Fasta

 

>prpE E. coli K12. Version NC_000913.3 GI:556503834
atgtcttttagcgaattttatcagcgttcgattaacgaaccggagcagttctgggccgag
caggcccggcgtattgactggcagacgccctttacgcaaacgctcgatcacagcaatccg
ccgtttgcccgttggttttgtgaaggccgaaccaacttgtgccacaacgccatcgaccgc
tggctggagaaacagccagaggcgctggcgctgattgccgtctcttcggaaacagaagaa
gagcgcacctttacctttcgtcagctgcatgacgaagtgaacgcggtggcctcaatgttg
cgttcattgggtgtgcagcgcggcgatcgggtgctggtgtatatgccgatgattgccgaa
gcgcatattactctgctggcctgcgcgcgcattggcgctattcactcggtggtgtttggt
ggatttgcctcgcacagcgtggcggcgcgaattgatgacgctaaaccggtgctgattgtc
tcggctgatgccggagcgcgcggtggcaaaatcattccctataaaaaattgctcgacgat
gcgataagtcaggcgcagcaccagccacgccatgttttgctggtggatcgcgggctggcg
aaaatggcgcgcgtcagcgggcgggatgtcgatttcgcgtcgttgcgccatcaacacatc
ggcgcgcgggtaccggtggcgtggctggaatccaacgaaacctcctgcattctctacact
tccggcacgaccggcaaacctaaaggcgtgcagcgtgacgtcggcggatatgcggtggcg
ctggcgacctcgatggacaccatttttggcggcaaagcgggcagcgtgttcttttgcgca
tcggatatcggctgggtggtggggcattcgtatatcgtttacgcgccgctgctggcgggg
atggcgactatcgtttacgaaggattgccgacctggccggactgcggcgtgtggtggaca
atcgtcgagaaatatcaggttagccggatgttctcagcgccgaccgccattcgcgtgctg
aaaaaattccctaccgctgaaattcgcaaacacgatctctcgtcgctggaagtgctctat
ctggctggagaaccgctggacgagccgaccgccagttgggtgagcaatacgctggatgtg
ccggtcatcgacaactactggcagaccgaatccggctggccgattatggcgattgctcgc
ggtctggacgacaggccgacgcgtctgggaagccccggtgtgccgatgtatggctataac
gtgcagttgcttaatgaagtcaccggcgaaccgtgtggcgtcaacgagaaagggatgctg
gtggtggaagggccgctgccgccggggtgtattcagaccatctggggcgacgacggccgc
tttgtgaagacttactggtcgctgttttcccgcccggtgtacgccacctttgactggggc
atccgtgacgctgacggttatcactttattctcgggcgcactgacgatgtaattaacgtt
gccgggcatcggctggggacgcgcgagattgaagagagtatctccagccatccgggcgtt
gccgaagtggcggtggttggggtgaaagatgcgctgaaagggcaggtggcggtggcgttt
gtcattccgaaagagagcgacagtctggaagatcgtgatgtggcgcactcgcaagagaag
gcgattatggcgctggtggacagccagattggcaactttggccgcccggcgcacgtctgg
tttgtctcgcaattgccaaaaacgcgatccggaaaaatgctgcgccgcacgatccaggcg
atttgcgaaggacgcgatcctggagatctgacgaccattgatgatcctgcgtcgttggat
cagatccgccaggcgatggaagagtag
              
                            

Download fasta file
RegulonDB