RegulonDB RegulonDB 11.1: Gene Sequence
mhpT gene sequence


Size: 1212        A: 188  T: 328  G: 407  C: 289

Fasta

 

>mhpT E. coli K12. Version NC_000913.3 GI:556503834
atgtcgactcgtaccccttcatcatcttcatcccgcctgatgctgaccatcgggctttgt
tttttggtcgctctgatggaagggctggatcttcaggcggctggcattgcggcgggtggc
atcgcccaggctttcgcactcgataaaatgcaaatgggctggatatttagcgccggaata
ctcggtttgctacccggcgcgttggttggcggaatgctggcggaccgttatggtcgcaag
cgcattttgattggctcagttgcgctgtttggtttgttctcactggcaacggcgattgcc
tgggatttcccctcactggtctttgcgcggctgatgaccggtgtcgggctgggggcggcg
ttgccgaatcttatcgccctgacgtctgaagccgcgggtccacgttttcgtgggacggca
gtgagcctgatgtattgcggtgttcccattggcgcggcgctggcggcgacactgggtttc
gcgggggcaaacttagcatggcaaacggtgttttgggtaggtggtgtggtgccgttgatt
ctggtgccgctattaatgcgctggctgccggagtcggcggttttcgctggcgaaaaacag
tctgcgccaccactgcgtgccttatttgcgccagaaacggcaaccgcgacgctgctgctg
tggttgtgttatttcttcactctgctggtggtctacatgttgatcaactggctaccgcta
cttttggtggagcaaggattccagccatcgcaggcggcaggggtgatgtttgccctgcaa
atgggggcggcaagcgggacgttaatgttgggcgcattgatggataagctgcgtccagta
accatgtcgctactgatttatagcggcatgttagcttcgctgctggcgcttggaacggtg
tcgtcatttaacggtatgttgctggcgggatttgtcgcggggttgtttgcgacaggtggg
caaagcgttttgtatgccctggcaccgttgttttacagttcgcagatccgcgcaacaggt
gtgggaacagccgtggcggtagggcgtctgggggctatgagcggtccgttactggccggg
aaaatgctggcattaggcactggcacggtcggcgtaatggccgcttctgcaccgggtatt
cttgttgctgggttggcggtgtttattttgatgagccggagatcacgaatacagccgtgc
gccgatgcctga
              
                            

Download fasta file
RegulonDB