RegulonDB RegulonDB 10.9: Gene Sequence
frmR gene sequence


Size: 276        A: 68  T: 61  G: 81  C: 66

Fasta

 

>frmR E. coli K12. Version NC_000913.3 GI:556503834
atgcccagtactccggaagagaagaaaaaggtccttactcgagttcgtcgtattcggggg
cagattgatgctctggaacggtcgctggagggtgatgccgaatgccgtgccatactccaa
cagatcgctgccgttcggggcgcggctaatgggctgatggcagaagtgcttgaaagccat
atccgggaaacgtttgaccgaaatgactgctacagccgcgaagtcagccaatccgttgac
gacactattgaactggttcgtgcctatcttaaatag
              
                            

Download fasta file
RegulonDB