RegulonDB RegulonDB 10.9: Gene Sequence
yaiO gene sequence


Size: 774        A: 191  T: 195  G: 193  C: 195

Fasta

 

>yaiO E. coli K12. Version NC_000913.3 GI:556503834
atgataaaacggacgttattagcggcggccatttttagcgcattgcccgcttatgccggg
ttaacttccattaccgcgggctacgattttaccgattattctggcgatcatggcaaccgt
aatttagcgtatgctgaactggtggcgaaagttgaaaacgcaacgctgctttttaatctt
tcccaggggcgtcgtgattatgaaactgaacatttcaatgccactcgcggtcagggtgcg
gtctggtataaatggaataactggctgacaacccgaacgggtattgcctttgcggataat
acgccggtctttgcccgccaggattttcgtcaggatattaacctggccctgttaccaaaa
acgcttttcacgaccggttatcgctacactaaatattacgatgatgtcgaagtcgatgcc
tggcaaggcggcgtatcactctatactggcccggtgatcaccagctaccgctatacccat
tatgactccagcgatgcaggtggtagttatagcaatatgatttccgtgcgtctgaatgac
ccgcgcggcactggttatacgcaactatggctaagccgcggaacaggtgcttacacctat
gactggacgccagaaacacgctacggcagcatgaagagcgtcagtctgcaacgtattcaa
ccgctgactgagcaacttaatctcgggctgacggcaggtaaagtgtggtacgacacccca
accgatgattttaacggtctgcaacttgcagcccgtctgacctggaaattctga
              
                            

Download fasta file
RegulonDB