RegulonDB RegulonDB 10.9: Gene Sequence
insC1 gene sequence


Size: 366        A: 100  T: 72  G: 105  C: 89

Fasta

 

>insC-1 E. coli K12. Version NC_000913.3 GI:556503834
atgattgatgtcttagggccggagaaacgcagacggcgtaccacacaggaaaagatcgca
attgttcagcagagctttgaaccggggatgacggtctccctcgttgcccggcaacatggt
gtagcagccagccagttatttctctggcgtaagcaataccaggaaggaagtcttactgct
gtcgccgccggagaacaggttgttcctgcctctgaacttgctgccgccatgaagcagatt
aaagaactccagcgcctgctcggcaagaaaacgatggaaaatgaactcctcaaagaagcc
gttgaatatggacgggcaaaaaagtggatagcgcacgcgcccttattgcccggggatggg
gagtaa
              
                            

Download fasta file
RegulonDB