RegulonDB RegulonDB 10.9: Gene Sequence
yaiX gene sequence


Size: 699        A: 192  T: 191  G: 162  C: 154

Fasta

 

>yaiX E. coli K12. Version NC_000913.3 GI:556503834
atggacttattgccttttttactggacgcgaacctcagcgcgacaaacccacccgctatt
ccgcactggtggaagcgtcaaccgcttattcccaaccttctgtcacaggaactgaaaaac
tatctgaagcttaatgttaaagagaaaaatattcagattgcagaccaggtaattattgat
gaaactgcaggtgaagttgttatcggcgcgaatacccgtatttgtcatggtgccgttatt
cagggtccggtagtgattggcgcaaactgcctgataggtaatagtaattatgcgtttatt
cgtcctggcacaataatcagcaatggcgtaaaaattggttttgccaccgagattaaaaat
gcggttattgaagcggaagcaacgattggtccgcaatgttttattgccgactcggtagtt
gcaaaccaggcatatttaggcgcacaagtacgtaccagtaatcatcgtctggatgaacag
cccgtgtctgttcgaactccagagggaattatcgctaccggatgcgataaattaggttgt
tatatcgggcagcgttcacgccttggcgtacaagttattattttgcctgggcgaattatt
tccccgaacacgcaacttggcccgcgcgtgattgtagaacgtaatttacctaccggaact
tattcactccgacaagaacttatccgtacaggagattaa
              
                            

Download fasta file
RegulonDB