RegulonDB RegulonDB 10.9: Gene Sequence
tauA gene sequence


Size: 963        A: 239  T: 182  G: 284  C: 258

Fasta

 

>tauA E. coli K12. Version NC_000913.3 GI:556503834
atggcaatttcatcgcgtaacacacttcttgccgcactggcattcatcgcttttcaggca
caggcggtgaacgtcaccgtggcgtatcaaacctcagccgaaccggcgaaagtggctcag
gccgacaacacctttgctaaagaaagcggagcaaccgtggactggcgtaagtttgacagc
ggagccagcatcgtgcgggcgctggcttcaggcgacgtgcaaatcggcaacctcggttcc
agcccgttagcggttgcagccagccaacaggtgccgattgaagtcttcttgctggcgtca
aaactgggtaactccgaagcgctggtggtaaagaaaactatcagcaaaccggaagatctg
attggcaaacgcatcgccgtaccgtttatctccaccacccactacagcctgctggcggca
ctgaaacactggggcattaaacccgggcaagtggagattgtgaacctgcagccgcccgcg
attatcgctgcctggcagcggggagatattgatggtgcttatgtctgggcaccggcggtt
aacgccctggaaaaagacggcaaggtgttgaccgattctgaacaggtcgggcagtggggc
gcgccaacgctggacgtctgggtggtgcgcaaagattttgccgagaaacatcctgaggtc
gtgaaagcgttcgctaaaagcgccatcgatgctcagcaaccgtacattgctaacccagac
gtgtggctgaaacagccggaaaacatcagcaaactggcgcgtttaagcggcgtgcctgaa
ggtgacgttccggggctggtgaaggggaatacctatctgacgccgcagcaacaaacggca
gaactgaccggaccggtgaacaaagcgatcatcgacaccgcgcagtttttgaaagagcag
ggcaaggtcccggctgtagcgaatgattacagccagtacgttacctcgcgcttcgtgcaa
taa
              
                            

Download fasta file
RegulonDB