RegulonDB RegulonDB 10.9: Gene Sequence
tauB gene sequence


Size: 768        A: 169  T: 169  G: 237  C: 193

Fasta

 

>tauB E. coli K12. Version NC_000913.3 GI:556503834
atgctgcaaatctctcatctttacgccgattatggcggcaaaccggcactggaagatatc
aacctgacgctggaaagcggcgagctactggtggtgctggggccgtccggctgcggtaaa
accaccctgctgaatctgattgccggttttgtgccttatcagcatggcagcattcaactg
gcgggtaagcgtattgagggaccgggagcagagcgtggcgtagtttttcagaatgaaggg
ctactaccgtggcgcaatgtacaggacaacgtggcgttcggcctgcaattggcaggtata
gagaaaatgcagcgactggaaatcgcgcaccagatgctgaaaaaagtggggctggaaggc
gcagaaaaacgctacatctggcagctttccggtggtcaacgtcagcgggtggggattgct
cgtgcgctggcggcgaatccccagctgttattactcgacgaaccgtttggtgcgctggac
gccttcacccgcgaccagatgcaaaccctgctgctgaaactctggcaggagacgggcaag
caggtgctgttgattacccacgatatagaagaagcggtgtttatggcgactgaactggtt
ctgctttcatccggccctggccgtgtgctggagcggctgccgctcaactttgctcgccgc
tttgttgcgggagagtcgagccgcagcatcaagtccgatccacaattcatcgccatgcgc
gaatatgttttaagccgcgtatttgagcaacgggaggcgttctcatga
              
                            

Download fasta file
RegulonDB