RegulonDB RegulonDB 10.9: Gene Sequence
tauC gene sequence


Size: 828        A: 139  T: 215  G: 268  C: 206

Fasta

 

>tauC E. coli K12. Version NC_000913.3 GI:556503834
atgagtgtgctcattaatgaaaaactgcattcgcggcggctgaaatggcgctggccgctc
tcgcgtcaggtgaccttaagcattggcacgttagcggttttactcaccgtatggtggacg
gtggcgacgctgcaactgattagcccgctatttttgccgccgccgcaacaggtactggaa
aaactactcaccattgccggaccgcaaggctttatggacgccacgctgtggcagcatctg
gcagccagtctgacgcgcattatgctggcgctatttgcagcggtgttgttcggtattccg
gtcgggatcgcgatgggacttagccctacggtacgcggcattctggatccgataatcgag
ctttatcgtccggtgccgccgctggcttatttgccgctgatggtgatctggtttggtatt
ggtgaaacctcgaagatcttactgatctatttagcgatttttgcaccggtggcgatgtcg
gcgctggcgggggtgaaaagcgtgcagcaggttcgcattcgtgccgcccagtcgctgggt
gccagccgtgcgcaggtgctgtggtttgtcattttgcccggtgcgctgccggaaatcctc
accggattacgtattggtctgggggtgggctggtctacgctggtggcggcggagctgatt
gccgcgacgcgcggtttaggatttatggttcagtcagcgggtgaatttctcgcaactgac
gtggtgctggcggggatcgcggtgattgcgattatcgcctttcttttagaactgggtctg
cgcgcgttacagcgccgcctgacgccctggcatggagaagtacaatga
              
                            

Download fasta file
RegulonDB