RegulonDB RegulonDB 10.9: Gene Sequence
ykiB gene sequence


Size: 219        A: 99  T: 59  G: 24  C: 37

Fasta

 

>ykiB E. coli K12. Version NC_000913.3 GI:556503834
gtggacatatataatttatggagaaaaacacgcatcaaattcataaaagcacagtatttc
aacatgttgcagataattttgtttttgaagcatacgcataataaatatcacaaacacaaa
ccagataaatatcctatgaatatgcaacaaagttttaattattcaatttatagcagcgca
accaaactccaaaaaataataaccaacagctataaataa
              
                            

Download fasta file
RegulonDB