RegulonDB RegulonDB 10.9: Gene Sequence
yaiW gene sequence


Size: 1095        A: 273  T: 237  G: 321  C: 264

Fasta

 

>yaiW E. coli K12. Version NC_000913.3 GI:556503834
atgtcgcgcgtcaatcctctatcttcgctgtcattgttggcggttctggttttagcgggg
tgtagtagtcaggctccgcaaccgttgaaaaagggcgaaaaagcgatagatgtagcgagc
gtcgtgcggcagaagatgcctgcgagcgtgaaagaccgcgatgcctgggcgaaagatctc
gccaccacctttgaaagtcaggggctggcaccgacgctggaaaacgtctgctcggtgctg
gcggtggcgcagcaggagtcaaattatcaggcagatccggccgttccgggcttaagcaag
atcgcctggcaagagattgaccgtcgtgctgaacggatgcacattcctgcttttctggtt
cataccgcgctaaaaatcaaatcgccaaacggcaaaagttatagcgaacggttagattcg
gtgcgtacagaaaagcaattgagcgcgatttttgacgatctgatcaacatggtgccaatg
gggcagacgctgtttggttcgctcaatccggtgcgcaccggtgggccgatgcaggtcagc
attgcttttgccgaacagcataccaaagggtatccgtggaaaatggacggtacagtccgt
caggaagtcttcagtcgccgcggcgggttgtggtttggtacttaccatttactgaattat
cccgccagttatagcgcaccgatataccgttttgctgattttaacgctggctggtacgcc
agccgtaatgccgcgtttcagaacgcggtcagtaaggccagcggcgtgaagctggcactg
gacggtgatttaattcgttacgacagtaaagaacccgggaaaaccgaactggcaacgcgc
aaactggctgcaaaactggggatgagcgacagcgaaattcgccgtcagttagagaaaggt
gacagcttctcttttgaggagacggcgctgtacaagaaagtttatcaacttgccgaaacg
aaaacgggtaaatcactcccccgcgaaatgttgcctggcattcaactggaaagcccgaaa
atcacccgcaacctgactacggcctggtttgcgaagcgcgtagacgaacggcgggcgcgt
tgtatgaaacagtga
              
                            

Download fasta file
RegulonDB