RegulonDB RegulonDB 10.9: Gene Sequence
yaiY gene sequence


Size: 309        A: 56  T: 91  G: 88  C: 74

Fasta

 

>yaiY E. coli K12. Version NC_000913.3 GI:556503834
atggctgatttcaccctgtcaaaatcgctgtttagcggaaaatatcgcaatgcctcttca
acgcctggcaacattgcctatgcgttgtttgtgctgttttgcttttgggctggggcgcaa
ttgctgaacctgttagtgcatgcgcccggcgtctatgagcgtttaatgcaggtccaggaa
acaggtcgcccacgggtggaaattggtttaggtgtcggcaccattttcgggctgatcccg
tttttagtaggctgcctcatttttgcagtggtggcgctatggctgcactggcgacatcgc
cgccagtaa
              
                            

Download fasta file
RegulonDB