RegulonDB RegulonDB 10.9: Gene Sequence
thiI gene sequence


Size: 1449        A: 349  T: 344  G: 398  C: 358

Fasta

 

>thiI E. coli K12. Version NC_000913.3 GI:556503834
atgaagtttatcattaaattgttcccggaaatcaccatcaaaagccaatctgtgcgcttg
cgctttataaaaatccttaccgggaacattcgtaacgttttaaagcactatgatgagacg
ctcgctgtcgtccgccactgggataacatcgaagttcgcgcaaaagatgaaaaccagcgt
ctggctattcgcgacgctctgacccgtattccgggtatccaccatattctcgaagtcgaa
gacgtgccgtttaccgacatgcacgatattttcgagaaagcgttggttcagtatcgcgat
cagctggaaggcaaaaccttctgcgtacgcgtgaagcgccgtggcaaacatgattttagc
tcgattgatgtggaacgttacgtcggcggcggtttaaatcagcatattgaatccgcgcgc
gtgaagctgaccaatccggatgtgactgtccatctggaagtggaagacgatcgtctcctg
ctgattaaaggccgctacgaaggtattggcggtttcccgatcggcacccaggaagatgtg
ctgtcgctcatttccggtggtttcgactccggtgtttccagttatatgttgatgcgtcgc
ggctgccgcgtgcattactgcttctttaacctcggcggcgcggcgcatgaaattggcgtg
cgtcaggtggcgcattatctgtggaaccgctttggcagctcccaccgcgtgcgttttgtc
gctattaatttcgaaccggtcgtcggggaaattctcgagaaaatcgacgacggtcagatg
ggcgttatcctcaaacgtatgatggtgcgtgccgcatctaaagtggctgaacgttacggc
gtacaggcgctggtcaccggcgaagcgctcggccaggtgtccagccagacgctgaccaac
ctgcgcctgattgataacgtctccgacacgctgatcctgcgtccgctgatctcttacgac
aaagagcacatcatcaacctggcccgccagattggcaccgaagactttgctcgcacgatg
ccggaatattgtggtgtgatctccaaaagcccgacggtgaaagcagttaaatcgaagatt
gaagcggaagaagagaagttcgacttcagcattctcgataaagtggttgaggaagcgaat
aacgttgatatccgcgaaatcgcccagcagaccgagcaggaagtggtggaagtggaaacc
gtcaatggcttcggcccgaacgacgtgatcctcgatatccgttctatcgatgaacaggaa
gataagccactgaaagtcgaagggattgatgtggtttctctgccgttctataaactgagc
accaaatttggcgatctcgaccagaacaaaacctggctgctgtggtgtgagcgcggggtg
atgagccgtctgcaggcgctctatctgcgcgagcagggctttaacaatgtgaaggtatat
cgcccgtaa
              
                            

Download fasta file
RegulonDB