RegulonDB RegulonDB 10.9: Gene Sequence
panE gene sequence


Size: 912        A: 230  T: 209  G: 240  C: 233

Fasta

 

>panE E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattaccgtattgggatgcggtgccttagggcaattatggcttacagcactttgc
aaacagggtcatgaagttcagggctggctgcgcgtaccgcaaccttattgtagcgtgaat
ctggttgagacagatggttcgatatttaacgaatcgctgaccgccaacgatcccgatttt
ctcgccaccagcgatctgctcctggtgacgctgaaagcatggcaggtttccgatgccgtc
aaaagcctcgcgtccacactgcctgtaactacgccaatactgttaattcacaacggcatg
ggcaccatcgaagagttgcaaaacattcagcagccattactgatgggcaccaccacccat
gcagcccgccgcgacggcaatgtcattattcatgtggcaaacggtatcacgcatattggc
ccggcacggcaacaggacggggattacagttatctggcggatattttgcaaaccgtgttg
cctgacgttgcctggcataacaatattcgcgccgagctgtggcgcaagctggcagtcaac
tgcgtgattaatccactgactgccatctggaattgcccgaacggtgaattacgtcatcat
ccgcaagaaattatgcagatatgcgaagaagtcgcggcggtgatcgaacgcgaagggcat
catacttcagcagaagatttgcgtgattacgtgatgcaggtgattgatgccacagcggaa
aatatctcgtcgatgttgcaggatatccgcgcgctgcgccacactgaaatcgactatatc
aatggttttctcttacgccgcgcccgcgcgcatgggattgccgtaccggaaaacacccgc
ctgtttgaaatggtaaaaagaaaggagagtgaatatgagcgcatcggcactggtttgcct
cgcccctggtag
              
                            

Download fasta file
RegulonDB