RegulonDB RegulonDB 10.9: Gene Sequence
yajQ gene sequence


Size: 492        A: 134  T: 112  G: 137  C: 109

Fasta

 

>yajQ E. coli K12. Version NC_000913.3 GI:556503834
atgccatctttcgatattgtctctgaagttgatcttcaggaagcacgtaacgcggtcgat
aacgcgagccgcgaagtggagtcccgttttgacttccgtaacgttgaagcctcatttgag
ctgaacgacgccagcaaaaccatcaaagtgttgagcgagtccgatttccaggtcaatcag
ttgctggatattctgcgtgccaagctgctgaagcgcggcattgaaggcagttcgctggat
gtaccggagaatatcgttcatagcggtaaaacctggtttgtggaagcgaaactgaaacag
ggcattgagagcgcgacccagaagaaaatcgtcaagatgatcaaagacagcaaactgaaa
gtgcaggcgcaaattcagggcgatgaaatccgcgtaacgggcaaatctcgtgatgatttg
caggctgtcatggcgatggtacgtggtggcgatctcggtcagccgttccagttcaaaaac
ttccgcgattaa
              
                            

Download fasta file
RegulonDB