RegulonDB RegulonDB 10.9: Gene Sequence
yajR gene sequence


Size: 1365        A: 285  T: 362  G: 396  C: 322

Fasta

 

>yajR E. coli K12. Version NC_000913.3 GI:556503834
atgaacgattataaaatgacgccaggtgagaggcgcgcgacctggggtttagggaccgta
ttctcgttgcgcatgctgggcatgtttatggttctgccggttctgaccacgtacggcatg
gctctgcaaggtgccagcgaagcattaatcggtattgccattggtatttatggtctgact
caggccgtttttcagattccgtttggcctgctttccgaccgcattggtcgcaaaccatta
attgtcggtgggctggcggtgtttgccgccggtagcgttatcgctgcgctttccgactcc
atctggggaattattctgggccgggcgctacaaggctctggagcaattgccgccgccgtt
atggcgctgctttccgatctcacgcgcgaacaaaaccgcaccaaagcgatggcgtttatc
ggcgtgagctttggcattacctttgccattgcgatggtgcttggcccgatcatcactcac
aaacttgggctgcacgcgctgttctggatgatcgctattctggcaacgaccggcattgcg
ttgaccatttgggttgtgcccaacagtagcactcacgtacttaatcgtgagtccggaatg
gtgaaaggcagtttcagtaaagtgctggcggaaccgcggctgctgaaactcaactttggc
attatgtgtctgcatattttgctgatgtcgacgtttgttgccctgcccggacaactggct
gatgcagggttcccggcggctgaacactggaaggtctatctggcgacaatgctaatcgcc
tttggctcggtcgtgcctttcattatctacgctgaagttaagcgcaaaatgaagcaagtc
tttgtcttctgcgtcgggttgatcgtggttgcggaaattgtgttgtggaacgcgcaaacg
cagttctggcaactggtggtcggcgtgcagcttttctttgtggcgtttaatttgatggaa
gccctcctgccctcacttatcagtaaagagtcgccagcaggttacaaaggtacggcgatg
ggtgtttactccaccagccagtttcttggcgtggcgattggcggttcgctgggcggctgg
attaacggcatgtttgacggtcagggggtatttctcgctggcgcaatgctggccgcagtg
tggctgacagtcgccagtaccatgaaagaaccgccgtatgtcagcagtttgcgcattgaa
atcccggcgaacattgccgcaaacgaggcgttaaaagtgcgtttgctagaaactgaaggc
atcaaagaagtgttgattgcagaagaagaacattcagcttatgtgaaaatcgacagcaaa
gtgacgaatcgctttgagatagaacaggcaattcgtcaggcataa
              
                            

Download fasta file
RegulonDB