RegulonDB RegulonDB 10.9: Gene Sequence
ybaV gene sequence


Size: 372        A: 101  T: 67  G: 115  C: 89

Fasta

 

>ybaV E. coli K12. Version NC_000913.3 GI:556503834
atgaaacacggaattaaagcactgctcattaccctgtccctggcctgtgccggaatgtct
catagcgcgctggcggcagcttctgtggcgaaaccgacggcggtagaaaccaaagcggaa
gctcctgcagcacaaagtaaagcagcagtaccggcgaaagccagtgacgaagaaggcacc
cgggtcagcattaataatgccagcgcggaagagctagcccgcgcgatgaatggcgttggc
ctgaagaaagcgcaggcgattgtcagttatcgcgaagagtacggtccgtttaaaactgtg
gaggatctaaagcaggtgccggggatgggcaattcgctggtggaacgtaatctggcggta
ttaaccctgtaa
              
                            

Download fasta file
RegulonDB