RegulonDB RegulonDB 10.9: Gene Sequence
fadM gene sequence


Size: 399        A: 116  T: 99  G: 100  C: 84

Fasta

 

>fadM E. coli K12. Version NC_000913.3 GI:556503834
atgcaaacacaaatcaaagttcgtggatatcatctcgacgtttaccagcacgtcaacaac
gcccgctaccttgaatttctcgaagaagcccgctgggatgggttggaaaatagcgacagt
tttcagtggatgacggcccataacatcgccttcgtcgtggtcaatatcaatattaactat
cgtcgcccagcggtattaagtgacctgttaactattaccagtcagttgcagcaattaaac
ggtaaaagcggcatcttaagccaggtcattacactggagccggaagggcaggtggtagcg
gatgcgcttattacgtttgtttgtattgatcttaaaacgcagaaagcattagctctggaa
ggggaattgcgcgaaaagctggagcagatggttaagtaa
              
                            

Download fasta file
RegulonDB